Putative Target Genes
 
 
 
 
 
 
Orthologous target genes pairs
 
 
 
 
     Human-Mouse

 
Human Mouse Rat

Putative Human Target Genes
Candidate ID
Host Gene
Host NM
Core mfe
Hairpin mfe
Core mfe/
hairpin mfe
Expression level
miRNA
Total Records
Eh104
THC1892219
NONE
-22.02
-36.62
0.6
7
-
333

Location
Optimal free
energy
Target NM
Target Gene
All miRNA hitting
this target gene
RNA duplex mfe
by RNAhybrid
RNA duplex mfe/
optimal free energy
Match start position
Hits
GO Info.
Target Seq.
5P -58.8 NM_148962 OXER1 All miRNAs -42 0.71 137 1 AGCACTGGCAGGACTCAGGTGGGTGG
5P -58.8 NM_144626 MGC17299 All miRNAs -39 0.66 248 1 TCTGTATCTCAGGTCAGTAGGCGCAG
5P -58.8 NM_015125 CIC All miRNAs -38.2 0.64 388 1 GGCTGGACTCAGGTTAGTTTGGGGGT
5P -58.8 NM_032902 PPP1R16A All miRNAs -37 0.62 124 1 GACACTGGCCCCTCTCAGGTCAGAAG
3P -56.6 NM_016276 SGK2 All miRNAs -36.4 0.64 18 1 ACCTGTGAAACTACTGAGGCCAGCTG
3P -56.6 NM_170693 SGK2 All miRNAs -36.4 0.64 18 1 ACCTGTGAAACTACTGAGGCCAGCTG
5P -58.8 XM_379668 LOC286208 All miRNAs -35.3 0.6 547 1 AGCCGGACTCAGGTGGGTCTGGAGGA
5P -58.8 NM_003731 SSNA1 All miRNAs -35.3 0.6 110 1 TCACTGTCTCAGGTGCCGAGAGGGGC
5P -58.8 NM_001012958 DISC1 All miRNAs -33.3 0.56 760 1 GACCTGTAAACTCAGGTCTGTGGAAC
5P -58.8 NM_003954 MAP3K14 All miRNAs -33.1 0.56 454 1 AACTCAGGTTCAGTGCAGAACCAGGT
3P -56.6 NM_004214 FIBP All miRNAs -32.8 0.57 106 1 GCCTGTGTCTGTCTCTGAGCACCTGG
3P -56.6 NM_198897 FIBP All miRNAs -32.8 0.57 106 1 GCCTGTGTCTGTCTCTGAGCACCTGG
5P -58.8 NM_001011668 CHCHD7 All miRNAs -32.7 0.55 428 1 CCACCTAGAATCTCAGGTGGGTGGAG
5P -58.8 NM_001011669 CHCHD7 All miRNAs -32.7 0.55 559 1 CCACCTAGAATCTCAGGTGGGTGGAG
5P -58.8 NM_024300 CHCHD7 All miRNAs -32.7 0.55 428 1 CCACCTAGAATCTCAGGTGGGTGGAG
5P -58.8 NM_001011667 CHCHD7 All miRNAs -32.7 0.55 559 1 CCACCTAGAATCTCAGGTGGGTGGAG
5P -58.8 NM_001011671 CHCHD7 All miRNAs -32.7 0.55 428 1 CCACCTAGAATCTCAGGTGGGTGGAG
5P -58.8 NM_001011670 CHCHD7 All miRNAs -32.7 0.55 559 1 CCACCTAGAATCTCAGGTGGGTGGAG
5P -58.8 NM_022066 E2-230K All miRNAs -32.7 0.55 299 1 TGCTGCCCCTTCTCAGGTCAGAGGCG
3P -56.6 XM_373904 LOC388780 All miRNAs -32.3 0.57 24 1 ACTGGAGTCTACTGAGATGAGGCTGT

First Page   1  2   3   4   >>  Last Page

 

y>